miércoles, septiembre 06, 2006

Leccion N°31: "La amistad entre nueras y suegras es peor que Rocco siffredi te la meta por el culo sin vaselina"



41 comentarios:

TheEgg dijo...

Una entrega de tres páginas. Sí señor, esto va a ser un excelente entretenimiento para sazonar la cena...

Después le cuento.

clau dijo...

jhajhja ernan, todo el dia estuve de mal humor, y no puedo negar, que todos los miercoles, llegando de la universidad me pongo a leer tus historietas, jhjahajhajhajahaj siemrpe acabo con ataqes de risa, los cuales la verdad son bastante frecuentes.. ¬¬ jhajhaaj bueno, el caso aqui es: tus historietas me divierten, si estoi de mal humor me ponen de buenas i provocan ataques de risa =) sigue asii =)
qe tengas buena semana.. i bonito dia, porqe aqi no va a estar bonito asta que deje de iover.. jhajahja baaaai

TheEgg dijo...

Al carajo la cena, ya me lo leí.
Voto por B (con prólogo de Rocco).

clau dijo...

pd.- Voto por la b, i perdon por la falta de coherencia, el sueño me esta atacando! jhajhaja babaii =)

Totoro dijo...

ladillas ladillas ladillas ladillas ladillas ladillas ladillas ladillas ladillas...

Tomás Ives dijo...

ta bueeno, bien cotitdiano...
jajajaja, hay coincidencias!
chau

Angel Mosquito dijo...

Con rzon tanto silecnio estos dis, mldito islamista de cuarta...esas tetas que te estan sliendo iban a terminar siendo causal de divorcio, porque esas tetas seductoras son productos de la inoperancia casera, de la dejadez (dejadez a tu señora que haga todo lo que vos no haces), la crianza de panza y pechos algun dia haría explotr a la pobre Juanita. Y encima vivis en SU casa, que mediocre y patético, por Dios! Vivir bajo el techo sionista...y no querer irse por comodo, y ahorrar, y qui viene lo máximo, para pagar a un abogado!!!
Has dado por tierra con toda tu patología discursistica obrera y anticapitalista proislámica.
Si te divorcias sabé que tenes un lugar en mi casa, asi no pasas frio en la puerta de la mezquita de Palermo que hizo tu islamico amigo Carlos Menem. Bah, en mi casa, en mi patio, es lo mismo, ahora se viene la calor y esta todo bien. Podes incluso dormir bajo la parrilla que acabo de terminar donde me hago unos asados de gato de exes kosher, total no llora. Una mujer judia borracha es peor que un Phantom cargado sobre Gaza, querido.

Voto por la historieta de tu madre, pero enamorada de Rocco.

salu, ah, la historieta, muy bien..pero un dia Max subio 4 paginas. Te cagó.

Juanete! dijo...

voto por "Madre con ladillas"!!

malanoche dijo...

Ladillas.
Ladillas.
Ladillas

Diego Agrimbau dijo...

voto por la madre de ernan con ladillas y rocco sifredi

Andres Biscaisaque dijo...

ladillas!!! ladillas!!!

GUSTABO dijo...

suuuuuuuuuuuuper!!!!!!!!
eres mi referente!!

=D

Kwaichang Kráneo dijo...

SObre tu entrega: Es positivo lo excesivo.

JeffStrikeryRoccoSiffredi dijo...

Bueno, por fin se hizo justicia!
Nos reclaman. En realidad lo reclaman a Rocco. Pero queselevaacé.
Ernán: Tenemos muchas ganas de pasar a nuestro equipo (y por nuestro equipo) a un mexicano prolífico como usted, que además nos puede prestar la casa de su madre para futuros banquetes (léase orgías).
Votamos, obviamente, porque en el próximo capítulo figuremos nosotros (o Rocco) pero vamos por más: Rocco, usted, y Mosquito con Ginger Lynn.
Pueden incluirse poleas, bolitas azules (a las que aludiera con entusiasmo infantil Mosquito en los comentarios a Biscaisaque, más abajo) o banderitas de Israel o Palestina.
Y al final, el toque maestro: nosotros dos los amuramos a ustedes dos a la pared. (No tenemos taladros).

YO MISMO dijo...

Ernan: infeliz pedazo de caca racista, cuando te agarre en bs as vas a volver a tu casa con los dientes dentro de una bolsita y la bolsita dentro del culo.....

es broma ernan. te quiero mucho, ¿verdad que sigue en pie la invitacion para quedarme en tu casa?

por otro lado, yo tambien votaria por el idilio madre de ernan/rocco sigfredi, pero con un toque de sutileza al estilo Jiro Taniguchi, con muchos disparos a lo Tarantino y con un final lleno de sexo ardiente en la playa de Acapulco, al mas puro estilo de telenovela mexicana.

Ah! tambien quiero ver payasos, y a Jorgete, y a Mosquito, y a Max y Fede besandose, y una revista de Oceano y Charquito camuflada en alguna viñeta, y una escena que haga alusion al heroico Eduardo Abaroa defendiento el Puente del Topater en Antofagasta.

juana dijo...

mosquito, yo encantada de que ernan se vaya a vivir a su casa, y al parecer marco viene a vivir a la mia. aunque pobre karin.....lo que va a tener que fregar, mientras yo me divierto con las aventuras de marquete y sus crisis existenciales

fede dijo...

mucha risa por aqui

Angel Mosquito dijo...

Juana, creo que no fui claro. Ernan va a vivir en el patiecito delantero de la casa, donde hay: maderas para quemar, dos gatos, una cubierta de bicicleta vieja que me traje de la calle, tres bicicletas en uso, unos 70 ladrillos, una bolsa de cal a medio usar, baldosas que sobraron, una perra de indeterminada edad (mas de 15 seguro)con dos operaciones a cuestas y una caja de carton a manera de cucha para el can. Ernan iría a vivir con la perra, digamos. Puede hacer caca en la vereda porque todo es muy agreste. Y puede comer lo que deja la perra, no habría problema con eso, se puede arreglar. Mi perra es buena onda, no como tu renegadohebraico marido. Y si te echan a vos, podes venir a mi casa tambien, que con karin se llevarian bien, Azul tiene un bebe con quien jugar y ustedes dos me harian la comida y limpiarían mis ropas. Vos podes dormir en el cuarto de huespedes, porque mi mansion tiene cuarto de huespedes.

Rocco:
Mi infantil entusiasmo con Ginger Lynn fue en la historieta de exes, y fue infantil porque a esa pelicula la vi casi de infante. pero acepto el desafio!

Fabian Zalazar dijo...

Voto por las ladillas robandose la cartera de tu vieja que acusa a Rocco sifredi.

Willy dijo...

Con lo que te ahorrás de no pagar alquiler, podés ir a una psicóloga, por ejemplo ,mi mujer, que también me propuso separarnos, mientras tanto yo la estiro para poder ahorrar algo mientras no pago alquiler...hay muchas similitudes en nuestras vidas, vecino, a propósito , ya están listos sus DVDs, supongo que los míos también están listos, así es que marquemos un encuentro para intercambiar material, y hasta podemos presentarlos a nuestros hijitos para que se hagan amigos...mandeme por mail su Teléfono y dirección asi arreglamos.
Y voto por Rocco y las ladillas.

Federico dijo...

Así no se puede.
Ladillas, por supuesto.

Kwaichang Kráneo dijo...

sobre las tazas: te advierto ernàn, que a Jerònimo León no le podès dar alcohol en su tacita hasta cumplido el primer año de vida, y en ese caso solamente vodka con naranja. Debe ser jugo de naranja exprimido, nada de fanta o basuras artificiales. Hay que vigilar la nutrición del niño.

johnholmesenbariloche dijo...

ernán: lo suyo es inquietante. ¿A qué números de la revista playboy se refiere? ¿Serán aquellos que le presté a fines de los 80, el de edda bustamante y karen reihjardt? Cuantas dudas!! Está usted está haciendo numerosos progresos al dejar atrás el abuso de mogólicos en sus paginas. Y desde ya, si lo echan de su casa siempre tendrá un revistero pegajoso amigo en la ciudad de los viajes de egresados... Voto por ron jeremy

Anónimo dijo...

Yo quiero ver las ladillas y a tu madre (que me perdone). Las revistas pegoteadas son las mismas que tiene Diego R. en su casa? Qué literatura te gustaba de niño? mmmm....
besos.
El sionista de América.

Anónimo dijo...

Aprende a escribir............vurro

Anónimo dijo...

A mi me parece que a vos si te gustaria que Rocco te la pusiera sin vaselina, o quizas ya te la puso y te mezclo las letras "cabezaso".............

Vale dijo...

jajjajajjajajjajjajjjajjajajjajajjajajjajjajajjajjajajjajajjajajaajajjjajajjajajjajjajjajjajajajjajajajjajajajjajajjaja!!!!!!!!!!!!!!!!!
Quiero a Rocco con ladillas en una fiesta increible con juana y tu mama!

Carochinaski dijo...

yo voto por ladillas que van al psicologo que es roco, pero en realidad cuando le sacan la mascara es el Marco, que estaba en complot con su madre (que lo acuso para no levantar sospechas).
Y ahora voy a hacer seis paginas, ya que todos nos hacemos los cancheritos.

Jose Antonio "Chiqui" Vilca dijo...

3 paginas!
q delicia!

joAco dijo...

ah... te hacés tres páginas para marcar tu machismo azteca, pero max, el hombre de la sexualidad dudosa, una vez hizo 4...

por lo tanto, esto vas a tener que hacer la semana que viene: 5 páginas
2 para la historia de rocco
2 para la de las ladillas
1 introductoria de sexo reconciliatorio con juana.

y se acabó el asunto

Emma dijo...

Esteem, Ernán:
Si van a incluir a toda esa gente apretada como en el camarote del barco de "Una noche en la Opera" de los Hermanos Marx, y especialmente actos de amuramiento (como dicen por ahí) entre señores, lo puede filmar casero?
Después lo vendemos para que lo pongan en el sector adultos de algún videoclú, al lado, por ejemplo, de títulos como "La doble boca de Erika", o algo así.
No digo "Anal fire" porque me da demasiada risa y tengo que parecer seria en mi laburo.
Puede pensar en títulos alternativos o .com.

ChamameSoldier dijo...

cuando gustes te podes exiliar en mi casa, tengo una habitación libre y estarías a solo dos cuadras de tu actual casa.
lo unico que te pido es que no estes revoleando las tetas cuando vienen invitados.
pero reitero: mi casa es tu casa.

Jose Antonio "Chiqui" Vilca dijo...

L
A
D
I
L
L
A
S
Clama el publico, en definitiva, y como siempre educativo el comic, ernan nos ilustrara una en un corte transversal, ademas si necesitas meter alguna en un microscopio electronico para verla asi a miles de aumentos, enviamela no mas por correo y yo aqui le tomo la foto.

ernan dijo...

Las cosas por su nombre:
Huevo: sazónese una milanesa a caballo…¿aunque esto podría ser considerado auto mutilación, canibalismo…? Vio los huevo cartoon, yo se que son malísimos, pero te cagas de risa eso que ni que…
Clau donde estas que no deja de llover…en el medio oriente? ahí no dejan de llover cuetazos de Israel, teledirigidos desde bella vista…lees historietas en la universidad, por dios que clase de profesional quieres ser?.
Huevo: no puede respetarse ni a usted mismo…que clase de hombre le chupa un HUEVO lo que se propone para si mismo? Obvio solo a un HUEVON, como HUEVO…igual yo soy como usted no se preocupe.
UN VOTO PARA LAS LADILLAS, CON UN EPILOGO DE ROCCO
Clau recién llega a la facultad y el sueño la esta atacando? Que estudia medicina forense en comisarías de pueblo?
2 VOTOS PARA LAS LADILLAS UN VOTO PARA EPILOGO DE ROCCO
Totoro: no sea tramposo/a, solo se vale un voto por participante¡
3 VOTOS PARA LADILLAS. UN VOTO PARA EPILOGO DE ROCCO.
Tomas Ives: que hace usted cargando a mi hijo?...hay coincidencias?...no estará hablando de la misma mujer no?...Geniales chistes hay en su pagina¡¡

Ángel mosquito: Mi abogado me pidió que por motivos judiciales no haga comentarios por un tiempo…lo de las tetas es una necesidad, años pidiéndole a mi mujer compartir la cama con otras damas y ella, y ella se negó que me deje las tetas para poder tocar cuatro tetas al mismo tiempo, no es lo que uno espera desde que es adolescente, es como un sueño que cuando se cumple resulta una cagada…yo dejo que sea SU casa porque estoy en contra de la propiedad privada
Agradezco tu invitación pero por una cuestión de clase no duermo fuera de la capital federal, donde los peronistas abundan y sacan los ojos a sus fugases victimas para que no los reconozcan después…a garabato le tengo ganas desde que me case con mi señora de nacionalidad rosarina, que es además de una ciudad donde se come buen gato, se hospeda de manera brillante a los historietistas que visitan sus festivales, no como los sabetellistas

4 votos para las ladillas. 2 votos para epilogo de rocco. 1 voto para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡

Juanaete: “madre con ladillas” jajaja, ojala algún momento la hubiese descubierto sus ladillas, así metía un juicio por alguna causa que debe existir y le saco la casa y me divorcio tranquilo de mi señora…
5 votos para ladillas. 2 votos para epilogo de rocco. 1 voto para que tenga 5 paginas y le rompa el culo a max de una buena vez que carazos¡

Malanoche: una persona un voto…una persona un voto…como en la facultad de ciencias sociales, para elegir al rector no?
6 votos para ladillas. 2 votos para epilogo de rocco. 1 voto para que tenga 5 paginas y le rompa el culo a max de una buena vez que carazos¡

Diego Agrimbau: 7 votos para ladillas. 3 votos para epilogo de rocco. 1 voto para que tenga 5 paginas y le rompa el culo a max de una buena vez que carazos¡
Andres Biscaisaque: 8 votos para ladillas. 3 votos para epilogo de rocco. 1 voto para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
Gustavo: soy tu referente? Tengo una lectora que va a la facultad? Que le pasa al mundo?
Kwaichang Kráneo: lo tomo como un voto a 5 paginas y le rompa el culo a max de una buena vez que carajos¡? Lo tomo y chau¡
8 votos para ladillas. 3 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
JeffStrikeryRoccoSiffredi: muchachos gracias por su invitación, siempre supe que la universidad del sexo me serviría para algo…la casa de mi madre esta siempre dispuesta, el problema es que circula mucha gente y mi erección tiene pánico escénico.
Mosquito cobra un para de panchos de cache, pero ginger lynn cobra mucho y después no friega los pisos.
8 votos para ladillas. 4 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
el marco tóxico: venís a casa seguro, de hecho estoy armando un taller textil, vas a conocer el famoso hotel cama caliente, tráete a jorgete y tendrás cama caliente doble¡
9 votos para ladillas. 5 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
Juana: así que gastas en locutorios la manutención que te paso para jeronimo? Esto lo sabrán tus abogados.
fede: te tomaste un acido]? Es normal
Ángel Mosquito: Me interesa de pareja esa perrita con experiencia¡
Fabian Zalazar dijo...
10 votos para ladillas. 6 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
Willy: será el barrio? Será la infructuosa búsqueda de piratear DVDs.? Seremos almas gemelas? Tengo tus Vds., lastima que no fuiste a la “presentación” del libro, lleve tus DVDs., te mando un mail y arreglamos
11 votos para ladillas.7 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
Federico: seguí tu consejo, no construí la casa porque me llevaría al divorcio, y que tenemos? Nada¡ no puedo reclamar ni un metro de casa¡
11 votos para ladillas. 6 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
Kwaichang Kráneo: Las tazas…una taza es mia en la división de bienes, la de jerónimo esta en disputa.
Johnholmesenbariloche:¿A qué números de la revista playboy se refiere? La primer revista que me acuerdo es una tetona inmensa que mas adelante supe era yuyito Gonzáles, le pedí a mi mamá que me la comprara porque había una “entrevista a el maromero Páez” quien era un boxeador mexicano que se bestia de payaso, play boy en México se llamaba signore…la primer play boy argentina que llego a mis manos era una chica en un culot, llamada Sandra villaruel, y había una nota de “la barra brava” termino que nunca entendí hasta que llegue a vivir a este país.
Está usted está haciendo numerosos progresos al dejar atrás el abuso de mogólicos en sus paginas. ¿Usted cree que tendría que existir una publicación erótica latí tipo playboy para deficientes mentales?
Y desde ya, si lo echan de su casa siempre tendrá un revistero pegajoso amigo en la ciudad de los viajes de egresados...podremos ir a las salidas de los boliches a ver si enganchamos a una minita borracha, usted me motiva, acelerare el proceso de divorcio
11 votos para ladillas. 6 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡
1 Voto por ron jeremy
El usuario anónimo dijo...
Diego R. tiene material que en este momento de mi vida no me interesa…a lo mejor mas adelante….no no creo igual¡
11 votos para ladillas. 6 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡ 1 Voto por ron jeremy
El usuario anónimo: Oquei hanimal¡
El usuario anónimo 2: A mi me que Rocco te la pusiera sin vaselina, y me firmara un autógrafo con su leche en mi eZpalda
Vale: Lo suyo es una película de la que no pienso participar a menos de que me pongan una mascara de cuero con un sierre en la boca…
12 votos para ladillas.7 votos para epilogo de rocco. 2 votos para que tenga 5 paginas y le rompa el culo a max de una buena vez que carajos¡ 1 Voto por ron jeremy

Che esperen un poco ahora continuo
Ernan
(tengo que hacer como que trabajo)

Anónimo dijo...

Que ganas de escribir boludeces que tenes ernan.............., vos debes ser como este que estan pasando ahora en canal 13.........................

Anónimo dijo...

como dedicado a la esposa de Max????!!! y que es una tremenda belleza???

Orkie dijo...

Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Si-Si-Fredi!
Ad infinitum...

GUSTABO dijo...

te das el trabajo de responderles a todos
ggggguuuuuaaaaauuuuuu!!!

dagnasty dijo...

Marco debería sospechar aunque sea un poquito de las intenciones de tu emprendimiento textil, Ernan. :)

Voto a todo sí, soy argentino, tengo el sí fácil, con un colchón me arreglan y con pago en cuotas también.-

lalala dijo...

lala-lala-lala-laladillas
lala-lala-lala-laladillas
lala-lala-lala-laladillas
lala-lala-lala-laladillas
acompañe la silabación melódica con la musiquita de batman

ART dijo...

yo voto por las ladillas, que fecha es el cierre de votacion?